Review



kalle gehring  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc kalle gehring
    Kalle Gehring, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/kalle+gehring/pGEX4T-HEPN+(Plasmid+%2375296)/bio_rxiv__64898__2025__12__18__694329-113-28-30
    Average 93 stars, based on 2 article reviews
    kalle gehring - by Bioz Stars, 2026-10
    93/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: The RNA-binding activity of SACSIN HEPN domain is connected to ARSACS
    Article Snippet: .. The following plasmids were purchased from Addgene: pDEST-cDNA5-FRT/TO-3*Flag-APEX2 N-term was a gift from Benjamin Blencowe (Addgene plasmid # 182925; http://n2t.net/addgene:182925 ; RRID: Addgene_182925); pGEX4T-HEPN was a gift from Kalle Gehring (Addgene plasmid # 75296; http://n2t.net/addgene:75296 ; RRID:Addgene_75296); pGEX6P1-Ubl-sr1(SIRPT1) was a gift from Kalle Gehring (Addgene plasmid # 75298; http://n2t.net/addgene:75298 ; RRID:Addgene_75298). pRetroX GFP Mps1 wt was a gift from Floris Foijer (Addgene plasmid # 63702; http://n2t.net/addgene:63702 ; RRID: Addgene_63702) The cDNA of the HEPN domain was PCR-amplified using the following primers: Forward 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTCCGTTGGCAATCCAGTGGAAGC-3’; Reverse 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTTACACTTTTTGTTGCATAAAATTTT CAAGT- 3’. .. The amplified cDNA was cloned into the pDonor201 through BP reaction of the gateway cloning strategy (11789020, ThermoFisher Scientific).

    Article Title: Mitochondrial survivin reduces oxidative phosphorylation in cancer cells by inhibiting mitophagy.
    Article Snippet: .. GST-Parkin-WT pGEX4T1 pGEX-parkin WT was a gift from Kalle Gehring (Addgene plasmid #45969; (Trempe et al., 2013) Table S1: DNA constructs used in this study J. ..

    Polymerase Chain Reaction:

    Article Title: The RNA-binding activity of SACSIN HEPN domain is connected to ARSACS
    Article Snippet: .. The following plasmids were purchased from Addgene: pDEST-cDNA5-FRT/TO-3*Flag-APEX2 N-term was a gift from Benjamin Blencowe (Addgene plasmid # 182925; http://n2t.net/addgene:182925 ; RRID: Addgene_182925); pGEX4T-HEPN was a gift from Kalle Gehring (Addgene plasmid # 75296; http://n2t.net/addgene:75296 ; RRID:Addgene_75296); pGEX6P1-Ubl-sr1(SIRPT1) was a gift from Kalle Gehring (Addgene plasmid # 75298; http://n2t.net/addgene:75298 ; RRID:Addgene_75298). pRetroX GFP Mps1 wt was a gift from Floris Foijer (Addgene plasmid # 63702; http://n2t.net/addgene:63702 ; RRID: Addgene_63702) The cDNA of the HEPN domain was PCR-amplified using the following primers: Forward 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTCCGTTGGCAATCCAGTGGAAGC-3’; Reverse 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTTACACTTTTTGTTGCATAAAATTTT CAAGT- 3’. .. The amplified cDNA was cloned into the pDonor201 through BP reaction of the gateway cloning strategy (11789020, ThermoFisher Scientific).

    Construct:

    Article Title: Mitochondrial survivin reduces oxidative phosphorylation in cancer cells by inhibiting mitophagy.
    Article Snippet: .. GST-Parkin-WT pGEX4T1 pGEX-parkin WT was a gift from Kalle Gehring (Addgene plasmid #45969; (Trempe et al., 2013) Table S1: DNA constructs used in this study J. ..



    Similar Products

    kalle gehring  (Addgene inc)
    93
    Addgene inc kalle gehring
    Kalle Gehring, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/kalle+gehring/pGEX4T-HEPN+(Plasmid+%2375296)/bio_rxiv__64898__2025__12__18__694329-113-28-30
    Average 93 stars, based on 1 article reviews
    kalle gehring - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier

    Image Search Results